What component is NOT needed for a PCR reaction?
Category: Uncategorized
What is the purpose of Ames test (1 point)? Explain the key…
What is the purpose of Ames test (1 point)? Explain the key procedures and expected results (2 points).
What is the primary receptor for HIV?
What is the primary receptor for HIV?
In order to detect Coronavirus RNA by real-time PCR, the vir…
In order to detect Coronavirus RNA by real-time PCR, the viral RNA needs to be converted into cDNA.
Describe two mechanisms used by bacteria to defend DNAs from…
Describe two mechanisms used by bacteria to defend DNAs from invading bacterialphages. (Required for only graduate students. Extra credit for undergrads.) Reasonable details are required for full credits. (2 points)
The stop codon UAG signals the DNA polymerase to stop replic…
The stop codon UAG signals the DNA polymerase to stop replicating the chromosome.
A lithotroph would be able to use ____ as a source of electr…
A lithotroph would be able to use ____ as a source of electrons?
Which of the following sequences could not be a restriction…
Which of the following sequences could not be a restriction enzyme cut site?
10 base PCR primers capable of amplifying this whole sequenc…
10 base PCR primers capable of amplifying this whole sequence:5’GTGGTCGATATCCGCGACGTCGAAGTGAATTTCAAGCAGCGTCTGTCCGGCGTTAC 3’would be forward 5’ GTGGTCGATA 3’ and reverse ____________ .
Transcription in eukaryotic microbes is not coupled to trans…
Transcription in eukaryotic microbes is not coupled to translation unlike that in prokaryotic microbes.