Skip to content

Buzz Folder

  • Home
  • Blog

Category: Uncategorized

49.  A ________________ is used in industrial microbiology t…

49.  A ________________ is used in industrial microbiology to produce microbial products that are only synthesized during log phase growth.

Published March 7, 2021
Categorized as Uncategorized

80.  Which of the following causes mutations by creating thy…

80.  Which of the following causes mutations by creating thymine dimers?

Published March 7, 2021
Categorized as Uncategorized

60.  Semiconservative DNA replication means that:

60.  Semiconservative DNA replication means that:

Published March 7, 2021
Categorized as Uncategorized

61.  Which of the following is NOT a characteristic of Okaza…

61.  Which of the following is NOT a characteristic of Okazaki fragments?

Published March 7, 2021
Categorized as Uncategorized

45.  The preferred method for long term storage of bacteria…

45.  The preferred method for long term storage of bacteria is _______________________.

Published March 7, 2021
Categorized as Uncategorized

95.  Photoheterotrophs use carbon dioxide as their sole carb…

95.  Photoheterotrophs use carbon dioxide as their sole carbon source.

Published March 7, 2021
Categorized as Uncategorized

94.  Essential amino acids are amino acids that cannot be sy…

94.  Essential amino acids are amino acids that cannot be synthesized by an organism and so must be provided as nutrients.

Published March 7, 2021
Categorized as Uncategorized

37.  A fastidious organism might be grown on which of the fo…

37.  A fastidious organism might be grown on which of the following types of media?

Published March 7, 2021
Categorized as Uncategorized

87.  In conjugation, F+ cells:

87.  In conjugation, F+ cells:

Published March 7, 2021
Categorized as Uncategorized

  Bonus Question ( Worth 10 points IF YOU SHOW YOUR WORK!) U…

  Bonus Question ( Worth 10 points IF YOU SHOW YOUR WORK!) Using the above table, give me the protein sequence made from the following sequence of DNA nucleotides: GATCTTTACTGGGGACTACCCAATGCCCACTTGATTGTATCG

Published March 7, 2021
Categorized as Uncategorized

Posts pagination

Newer posts Page 1 … Page 59,560 … Page 61,147 Older posts
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Buzz Folder
Proudly powered by WordPress.