49. A ________________ is used in industrial microbiology to produce microbial products that are only synthesized during log phase growth.
Category: Uncategorized
80. Which of the following causes mutations by creating thy…
80. Which of the following causes mutations by creating thymine dimers?
60. Semiconservative DNA replication means that:
60. Semiconservative DNA replication means that:
61. Which of the following is NOT a characteristic of Okaza…
61. Which of the following is NOT a characteristic of Okazaki fragments?
45. The preferred method for long term storage of bacteria…
45. The preferred method for long term storage of bacteria is _______________________.
95. Photoheterotrophs use carbon dioxide as their sole carb…
95. Photoheterotrophs use carbon dioxide as their sole carbon source.
94. Essential amino acids are amino acids that cannot be sy…
94. Essential amino acids are amino acids that cannot be synthesized by an organism and so must be provided as nutrients.
37. A fastidious organism might be grown on which of the fo…
37. A fastidious organism might be grown on which of the following types of media?
87. In conjugation, F+ cells:
87. In conjugation, F+ cells:
Bonus Question ( Worth 10 points IF YOU SHOW YOUR WORK!) U…
Bonus Question ( Worth 10 points IF YOU SHOW YOUR WORK!) Using the above table, give me the protein sequence made from the following sequence of DNA nucleotides: GATCTTTACTGGGGACTACCCAATGCCCACTTGATTGTATCG