Skip to content

Buzz Folder

  • Home
  • Blog

Category: Uncategorized

What is the purpose of Ames test (1 point)? Explain the key…

What is the purpose of Ames test (1 point)? Explain the key procedures and expected results (2 points).

Published February 26, 2021
Categorized as Uncategorized

What is the primary receptor for HIV?

What is the primary receptor for HIV?

Published February 26, 2021
Categorized as Uncategorized

In order to detect Coronavirus RNA by real-time PCR, the vir…

In order to detect Coronavirus RNA by real-time PCR, the viral RNA needs to be converted into cDNA.

Published February 26, 2021
Categorized as Uncategorized

Describe two mechanisms used by bacteria to defend DNAs from…

Describe two mechanisms used by bacteria to defend DNAs from invading bacterialphages. (Required for only graduate students. Extra credit for undergrads.) Reasonable details are required for full credits. (2 points)

Published February 26, 2021
Categorized as Uncategorized

The stop codon UAG signals the DNA polymerase to stop replic…

The stop codon UAG signals the DNA polymerase to stop replicating the chromosome.

Published February 26, 2021
Categorized as Uncategorized

A lithotroph would be able to use ____ as a source of electr…

A lithotroph would be able to use ____ as a source of electrons?

Published February 26, 2021
Categorized as Uncategorized

Which of the following sequences could not be a restriction…

Which of the following sequences could not be a restriction enzyme cut site?

Published February 26, 2021
Categorized as Uncategorized

10 base PCR primers capable of amplifying this whole sequenc…

10 base PCR primers capable of amplifying this whole sequence:5’GTGGTCGATATCCGCGACGTCGAAGTGAATTTCAAGCAGCGTCTGTCCGGCGTTAC 3’would be forward 5’ GTGGTCGATA 3’ and reverse ____________ .

Published February 26, 2021
Categorized as Uncategorized

Transcription in eukaryotic microbes is not coupled to trans…

Transcription in eukaryotic microbes is not coupled to translation unlike that in prokaryotic microbes.

Published February 26, 2021
Categorized as Uncategorized

Most of the current Flu vaccines are produced in embryonated…

Most of the current Flu vaccines are produced in embryonated eggs.

Published February 26, 2021
Categorized as Uncategorized

Posts pagination

Newer posts Page 1 … Page 59,388 … Page 60,202 Older posts
Powered by Studyeffect
  • Privacy Policy
  • Terms of Service
Buzz Folder
Proudly powered by WordPress.